L’homme sauvage et la preuve : L’orang pendek

Illustration de Tim Bertelink ( CC BY-SA 4.0 )

Le second volet de notre revue de preuves va s’intéresser à l’orang pendek, le « petit homme» sauvage de Sumatra, en Indonésie. Un des plusieurs hommes sauvages censés hanter les forêts et plantations de Sumatra serait sans doute plus précis,  ce qui n’est pas l’objet de ce texte, mais qui est développé dans cet entretien.

On l’a souvent entendu, orang pendek pourrait bien être le premier des hommes sauvages à être authentifié scientifiquement.

Pour plusieurs raisons : il y a des indications et des éléments de crédibilité, de très hautes valeurs, que nous allons décrire dans cet article. D’après moi, ce qui singularise également orang pendek par rapport aux autres hommes sauvages recensés aux quatre coins du monde est simple :  orang pendek n ‘est pas si rare, et il est relativement aisé de sentir sa présence.

Le Gunung Tujuh (lac des 7 montagnes), 2100 mètres d’altitude

Je fais référence ici au Gunung Tujuh,  cet ancien cratère volcanique de l ‘ouest de Sumatra ( province de Jambi), situé dans une partie accessible du plus vaste espace naturel indonésien: le parc national de Kerinci Seblat. C’est à cet endroit que se concentrent les recherches à son sujet. Orang pendek est vu, observé, dans tout Sumatra, notamment au nord de l‘île, mais au Gunung Tujuh, sa présence est encore plus évidente. Comme j’ai eu la chance d’en faire l‘expérience, au bout de quelques heures sur le terrain, nous avons pu entendre ce cri ( une sorte de Hou-Hou, profond, grave, qui résonne dans toute la forêt) qui lui est attribué et voir ces empreintes si étranges. Des traces différentes par leurs tailles, montrant la présence de plusieurs individus, dont certains indiquaient une taille d’1m75 (5,7 pieds).

Empreinte d’orang pendek, in situ

C’est à mon sens, la raison principale qui fait de l’orang pendek, une créature prise au sérieux par de nombreux scientifiques.  On se rapproche ici facilement d’une expérience reproductible.

Mais qu’en est-il réellement sur place ? Lors de mon séjour à Sumatra en 2013, nous avions demandé à un biologiste local spécialisé en zoologie, le professeur Wilson Novarino de l‘université de Sengai Penuh, la grande ville de Sumatra, son opinion à ce sujet. Voici ce qu’il nous répondit en substance : « Au début des années 2000, nous avons lancé un vaste programme pour dresser un inventaire des espèces animales présentes à Kerinci Seblat. Des dizaines de pièges caméras ont été laissés en forêt, pendant plusieurs années. Nous avons réussi à capturer en films, ou en photos, des spécimens de toutes les espèces présentes sur l’île. C’est comme cela que nous avons vu que les tigres étaient encore bien présents. Seules deux animaux ont échappé à cette campagne de détection : le rhinocéros et l’orang pendek. Nous en avons déduit que les rhinocéros sont éteints sur l‘île, et que l’orang pendek n ‘a jamais existé.»

Cependant, le professeur ne nous a pas confirmé que des caméras avaient été posées précisément au Gunung Tujuh.  

Mais peu importe, même si d’autres scientifiques, comme les primatologues Ahmad Januar, de Java,  ou David Chivers, de Cambridge sont eux,  convaincus de son existence, orang pendek reste pour l’instant une légende, c’est un fait. Et évidemment aucun programme de recherches officiel n’a été mis en place à son égard.

Les seules recherches existantes, sont celles que mènent sur le terrain les cryptozoologues. A Sumatra même,  avec le travail mené par Dally Sandradiputra également avec l‘effort de long terme entrepris par le CFZ-UK. Et les résultats sont loin d’être négligeables. Collecte de témoignages, d’empreintes, certes, mais aussi, et c’est ce qui nous intéresse ici, collecte d’éléments biologiques.

En 2001, une expédition conduite par l’explorateur et auteur Adam Davies et Andrew Sanderson a marqué une étape importante qui a permis de transformer la légende du « petit homme de Sumatra » en objet scientifique. Les empreintes relevées ont été étudiées par le Pr David Chivers, primatologue de l’Université de Cambridge, expert en primates d’Asie, qui en a déduit qu’elles montraient une anatomie unique. Des traits humains, avec l’implantation et l‘épaisseur de ces courts orteils mélangés avec des traits simiesque avec ce gros orteil latéral, qui part de très bas, et qui ressemble à  celui de l‘orang-outan ou bien du siamang. Un mélange improbable certes, mais palpable, entre le singe et l’homme.

A gauche, un moulage d’empreinte d’orang pendek réalisé par Dally Sandradiputra, à droite pour comparaison, les empreintes de primates

Lors de cette expédition, des échantillons de poils ont été récoltés à proximité d’une empreinte.

Ils ont été envoyés pour analyse à un zoologue australien d’origine suisse, spécialiste réputé de l‘identification des espèces animales. Le Dr Hans Brunner, de la Deakin University de Melbourne,  est très célèbre  pour avoir résolu une importante affaire criminelle en Australie, et avoir innocenté une mère de famille.  Dr Brunner a aussi mis sur pied un protocole d’identification des espèces animales qui est largement utilisé aujourd’hui. Il a passé de longs mois a étudier la structure des poils et en a conclu qu’ils provenaient d’une espèce inconnue.

L’analyse morphologique du Dr Hans Brunner, les 3 derniers échantillons « inconnus » seraient peut-être issus de l ‘orang pendek

Comme l’explique Adam Davies dans cet article, Brunner a postulé que la créature la plus proche de l’orang-pendek serait probablement l’orang-outan. Mais il a aussi dit que les échantillons présentaient des différences structurelles uniques qui les rendaient très différents des cheveux d’orang-outan. De nouveau nous voilà confrontés à ce mélange humain/singe.

Une expédition du CFZ à Sumatra avec notamment Adam Davies et Richard Freeman

En 2009, Adam Davies, au cours d’une autre de ses expéditions à Kerinci Seblat, a suivi une piste d’empreintes d’orang pendek, et à un endroit, il est apparu que la créature avait semblé se frotter contre un arbre. Adam Davies a prélevé des poils qui étaient restés sur le tronc, qui ont été ensuite analysés par Lars Thomas, un biologiste danois qui collabore avec l‘Université de Copenhague, également membre du CFZ. Voici son compte-rendu :  

Une petite partie de l’échantillon de poils a été soumis à une analyse ADN, mais en raison de la faible quantité d’ADN extrait et son état plutôt mauvais, aucune conclusion définitive ne peut être tirée. L’ADN a montré quelques similitudes avec l’ADN de primate, peut-être d’orang-outan, mais les résultats ne sont pas entièrement fiables. Suite à cela, j’ai soumis les cheveux restants à une analyse morphologique pour voir si cela pouvait apporter une quelconque information qui pourrait révéler l’identité du propriétaire des poils. J’ai vérifié tous les 6 cheveux restants et ils étaient tous compatibles avec les poils de grands primates ou d’humains. Ils avaient tous la moelle assez grande avec beaucoup de pigmentation typique des grands primates, avec  une alternance de trous au centre des poils, les faisant paraître un peu comme des troncs d’arbres évidés. J’ai comparé les échantillons de poils avec des échantillons de référence de 3 espèces différentes de gibbon, d’orang-outan, de chimpanzé et de bonobo, de gorille et une quinzaine d’échantillons de poils humains de différentes couleurs, principalement rouges ou rougeâtres. Je n’a jamais pu établir leur identité avec une certitude totale, bien que je puisse en éliminer certains. Les cheveux n’étaient pas humains, et ils ne provenaient pas de siamangs ou d’autres gibbons.

A gauche, le poil d’orang pendek étudié au microscope par Lars Thomas, comparé à un cheveux humain roux et à un poil d’orang outan.

Ils ont une couleur rouge rouille très profonde, très similaire à la couleur des poils d’orang-outan, mais variée dans d’autres détails structurels. Donc, sur la base de ces seuls résultats, j’ai conclu que les poils provenaient d’une espèce étroitement liée aux orangs-outans ou d’une forme d’orang-outan que je n’avais jamais vu auparavant.

Pour ce scientifique rigoureux, ce n’est pas une preuve suffisante pour proclamer la découverte d’une nouvelle espèce, mais c’est une indication claire qu’il existe à Sumatra un primate inconnu.

Détail qui a son importance : il est établi officiellement qu’il n ‘y a aucun orang-outan dans l’ouest de Sumatra où ces poils ont été récoltés.  Les orang outans sont présents uniquement dans le nord de l ‘île.

Aires de répartitions des orang outans. Tous les échantillons biologiques évoqués dans cet article proviennent du parc national de Kerinci Seblat

En 2010, une partie de ces échantillons a finalement pu faire l‘objet d’une analyse génétique par le Pr. Gilbert, directeur de l’institut de génétique du Muséum d’histoire naturelle du Danemark, et de l’Université de Copenhague. Thomas Gilbert enseigne la paléogénétique, c’est un  des meilleurs spécialistes mondiaux de l’analyse des poils et des cheveux. Et comme un certain nombre de scientifiques de premier plan, il n‘écarte pas totalement la possibilité qu’un de ces mythiques hommes sauvages soit un jour découvert. Il laisse une petite porte ouverte, et accueille avec bienveillance les demandes d’analyses de la part des cryptozoologues les plus sérieux.

Thomas Gilbert a pu extraire une quantité suffisante d’ADN de l’échantillon de poils, lui permettant de conclure que ces cheveux étaient soit humains, soit très étroitement liés à l’homme.

Pour lui, ce sont des résultats qui coupent court à toute polémique, l’origine humaine ne faisant pas de doute. Mais cela contredit l‘analyse morphologique de son compatriote Lars Thomas, qui lui aussi maintient fermement sa position : ces poils ne peuvent pas être humain.

Alors, qui a raison parmi toutes ces études scientifiques, humain ou bien orang pendek-c’est à dire à la fois humain et orang-outan ?

Je me suis donc rendu en 2013 pour le tournage de mon documentaire Yéti y es-tu ? à Sumatra. J’ai eu la chance de suivre Richard Freeman du CFZ, qui connaît très bien le terrain. Richard, qui contribue largement à ce blog,  est avant tout le directeur du département zoologie du CFZ-UK, il fut auparavant soigneur dans un parc zoologique. C’est donc  un expert du monde animal, il a côtoyé de nombreuses espèces de très près.  Il a écrit un ouvrage passionant sur l‘orang pendek.

Notre groupe était composé d’une équipe de professionnels chevronnés, des guides et d’alpinistes locaux, de Richard Freeman, d’Adele Morse, une artiste talentueuse qui a produit notamment de splendides sculptures de l’orang pendek, et de Dally Sandradiputra qui est sans aucun doute le plus actif cryptozoologue d’Indonésie.

Nous avons campé au Gunung Tujuh pendant une semaine, nous avons récolté une belle empreinte ( le manque de plâtre nous a limité, quelle erreur !), que le primatologue Ahmad Yanuar, et le biologiste Wilson Novarinio ont jugé provenir d’un hominidé (mais pas d’un homme), notamment par sa taille et certains traits humains.

Et nous avons récolté de nombreux échantillons de poils, à proximités d’empreintes caractéristiques de l‘orang pendek. Une partie de ce matériel  s’est avérée être des fibres végétales, mais quelques éléments étaient dignes d’être analysés, et une nouvelle fois, le Pr Gilbert a accepté de les étudier (un autre remerciement au passage).

Voici les résultats obtenus :

Le résultat humain m‘a alors un peu surpris, puisqu’il s’agissait de longs poils marron clair,  dont une partie du bulbe avait été conservée. Le laboratoire a accepté de me communiquer la séquence, puis le chromatogramme c’est à dire le résultat complet du séquençage. Pour résumer le processus, les poils sont d’abord dissous dans une solution javellisée, réduits à l‘état de liquide, les scientifiques en extraient alors la structure génétique, exprimée par un alignement de lettres.

Voici la séquence :

TGACNNTCAGGGTATTNCNTTTCATGCTGGTAGAGCTTCTCCATTCATAGCGAACTACTATACTCAGTTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGTGATGCTAAGTGTCCCCCCTGGTTCTTCACTGCTTCCCGAATGTCGCGACCTGGCATAAGTTGTCCGGCGTCTACATCTCCAACTGCCCATTGTGAAATGTCTTGAAAGTTCCAACTGTCGCTTTATCTAGTAATACCTATGTAACCTTAATGGTCTGTTCTCTTCGTTTTGTTGCTATGCCTGAATACTTCAAAGAACTTTGGCAGATAAGTATCTTGAGGTCCATTAACCCCCCGATTTTTTCTGTACTT

et voici le chromatogramme :

En voulant vérifier, autant que possible par moi-même l ‘origine de cet ADN, et confirmer le résultat que l‘on m‘a annoncé,  j’ai codé la séquence pour un test sur le site de l’ institut national américain pour l’information biologique moléculaire, qui permet a chacun, gratuitement et en quelques seconde de déterminer l’espèce du propriétaire d’une séquence génétique animale. On appelle cette démarche : exécuter un BLAST. Vous sélectionnez quelle espèce vous suspectez d’en être à l‘origine, puis vous copiez collez votre séquence. En la comparant avec les archives conservée par cette institution, vous obtenez un pourcentage de compatibilité.

Cette séquence là, logiquement réagit positivement quand on la compare à l‘Homo sapiens.

Comparons maintenant la séquence avec l’orang-outan. Surprise, on obtient la même probabilité, 97% :

Avec le chimpanzé, on obtient carrément 100 % de correspondance ! ( contre 0% de chance dans la vraie vie de croiser un chimpanzé à l ‘état sauvage à Sumatra)

Par contre le siamang lui, réagit moins que les grands singes:

  Et voici le résultat quand vous recherchez la proximité avec un organisme qui n ‘est pas un primate, par exemple un ours malais, ou tapir : aucune correspondance

Nous sommes donc ici en présence d’un matériel génétique qui est considéré comme humain, mais qui pourrait aussi ne pas l ‘être. C’est très excitant, mais très confus en même temps. Pour en savoir plus, j’ai sollicité l’avis d’un chercheur du muséum d’Histoire naturelle de Paris, anthropologue spécialisé dans la génétique, qui a tenu a rester anonyme.

Pour résumer nos longs échanges : sur les 350 paires de chromosomes qui composent la séquence, seule 70 correspondent à quelque chose de vivant, le reste de réagit à rien de connu. Est-ce le signe qu’il s’agit d’une nouvelle espèce de primate, mélangeant des traits humains et simiesques ? Peut-être mais en même temps, pas vraiment. Voyons comment l’explique notre expert :

L’ADN des poils que vous avez prélevé a probablement subi des dégradations (température, transport, UV) avant, pendant et après votre prélèvement et avant le séquençage.
L’ADN mitochondrial que les généticiens ont cherché à séquencé fait normalement 369 paires de bases. S’il a été dégradé, il est très probable que la réaction de séquençage ait fonctionné pour les 70 premières bases, mais après plus rien vu que l’ADN à séquencer est dégradé. Alors, la séquence que vous obtenez est composée comme suit :
De la 1ère lettre jusqu’à la 70ème on a effectivement la séquence mitochondriale de l’échantillon. De la 71ème à la 350ème base, c’est juste une construction aléatoire de A, T, G, et C. C’est comme si pour chacune des lettres suivantes, vous tiriez à chaque fois un dé à 4 faces et le résultat donne la lettre de la séquence. Cela ne reflète donc aucune réalité biologique de l’échantillon à séquencer, juste une suite de 4 lettres organisées aléatoirement.


Dommage. Mais quel est son avis sur l’interprétation. Humain ou pas humain ?

Trouver une séquence qui ne s’aligne pas à 100% avec celle de référence est tout à fait normal et attendu, sauf si on séquence la mitochondrie de son frère jumeau.
Là où les choses se corsent, c’est que le chimpanzé partage plus de 99,99% de sa séquence avec celle de l’homme. Donc, vous prenez une séquence de mitochondrie de chimpanzé, vous l’alignez avec celle de l’humain et vous allez trouver en moyenne 6 à 11 paires de bases qui différent parmi les 350 de notre séquence. J’espère que vous voyez déjà poindre le vaste dilemme: si je trouve 7 différences, est-ce que cela veut dire que j’ai un homme très différent , ou est-ce que j’ai un chimpanzé ?
Nous pouvons en fait répondre à cette question… (Pour faire extra simple: les mutations de la séquences du Chimpanzé ne se trouvent pas toujours aux mêmes endroits que celles qu’on trouve entre deux hommes.) Mais pour se faire, il faut au moins la séquence mitochondrial (369 paires de bases) entière. Sur seulement 70 paires de bases, je suis incapable de vous dire si c’est de l’homme à 80% de chance ou si c’est du chimpanzé à 79,99%…
Pour revenir au cas qui nous intéresse, il se trouve que vos 70 paires de bases s’alignent mieux, pour une seule petite mutation avec l’orang-outan (celui de référence) qu’avec l’Homm
e. Il m’est impossible sans plus de données de trancher entre ces deux possibilités tout aussi probable sur la base de nos résultats l’une que l’autre:
– Il s’agit d’un Orang-outan qui n’est pas de la même famille que celui de référence , car il a 1 petite différence sur les 70 paires de bases.
Ou bien :
– Il s’agit d’un Homme avec 2 mutations sur les 70 paires de bases qui le différencie de l’humain de référence, ce qui doit a priori être le cas de plus de 99.99999% de la population mondiale.

Le fait qu’il n’y ait pas d’orang-outan dans la région dont vous parlez m’incite à penser que : soit c’est un autre singe proche mais absent de mes bases de données génétiques, soit c’est de l’homme.

Enfin, une dernière possibilité qu’on ne peut scientifiquement écarter à ce moment là de la partie: c’est en effet « autre chose », mais là, il faudra beaucoup plus de « vraies » données génétiques pour le confirmer.

Alors, oui il y a une petite chance que cette séquence génétique issue de longs poils clairs décrive un primate inconnu, même si probablement, selon les « lois » de la génétique, elle provient d’un de ces nombreux hippies scandinaves qui parcourent cette forêt. (oups)

Multiplier les indices matériels apportera à coup sûrs des progrès. Mais comme nous l’expliquions dans le premier article de cette série, un résultat ambigüe, ou de l’ADN inconnue ne signifie pas une nouvelle espèce. Au pire, il ne s’agit que d’interprétations plus ou moins étayées, et, au mieux d’indications mais cela ne peut pas être une preuve. Les analyses génétiques sont une jungle, dans laquelle on peut facilement s’égarer, c’est à dire proclamer des résultats qui ne sont pas formellement établis, interpréter selon ce que l’on voudrait y trouver. Ou bien alors passer à côté de l ‘essentiel.

L’accumulation d’indices autour de l’orang pendek, et le manque d’écho dans la communauté scientifique nous montre le chemin laborieux, et sans fin, que doit emprunter, tel Sisyphe, celui qui veut prouver l ‘existence biologique de l’ homme sauvage.

Votre commentaire

Entrez vos coordonnées ci-dessous ou cliquez sur une icône pour vous connecter:

Logo WordPress.com

Vous commentez à l’aide de votre compte WordPress.com. Déconnexion /  Changer )

Photo Google

Vous commentez à l’aide de votre compte Google. Déconnexion /  Changer )

Image Twitter

Vous commentez à l’aide de votre compte Twitter. Déconnexion /  Changer )

Photo Facebook

Vous commentez à l’aide de votre compte Facebook. Déconnexion /  Changer )

Connexion à %s

Ce site utilise Akismet pour réduire les indésirables. En savoir plus sur la façon dont les données de vos commentaires sont traitées.